Re-Checking Guide RNA Sites in DiNV Genome

sgRNAs and their BLAST results to the DiNV genome

BLAST parameters:

  • Using the sgRNA sequence with the PAM site
  • Using D. virilis genome
  • Using RegSeq genome database only
  • Filter to e value of 0 to 10 only (or if there were more than 20, only looked at between 0 and 1)

Then: Look through each entry and see if there are any BLAST hits that include the 23bp, meaning that the entire PAM site is there, which means there is a chance of the Cas9 cutting.

Site set # bp region Site # activity score direction bp with PAM BLAST GGG BLAST TGG BLAST AGG BLAST CGG Notes
1 77kb 86 0.713 reverse 5’ ACACAAGTGTTGTTATACGATGG 3’ No hits with below 10 E value including GGG PAM 1 hit with 4.8 E value, 14/14 identity, includes TGG PAM No hits with below 10 E value including AGG PAM No hits with below 10 E value including CGG PAM  
1 77kb 92 0.719 forward 5’ AAAAAATGCACTAAAACACAGGG 3’ No hits with below 10 E value including GGG PAM No hits with below 10 E value including TGG PAM 1 hit with 4.8 E value, 17/18 identity, AGG PAM No hits with below 10 E value including CGG PAM  
1 77kb 27 0.716 reverse 5’ TGTATTGTCAGTGTGGGAGATGG 3’ 1 hit with 0.077 E value, 17/17 identity, GGG PAM. 3 hits with 4.8 E value, 14/14 identity, GGG PAM. 1 hit with 0.077 E value, 17/17 identity, includes TGG PAM. 2 hits with 4.8 E value, 14/14 identity, includes PAM 3 hits with 4.8 E value, 14/14 identity, includes PAM 1 hit with 4.8 E value, 14/14 identity, includes PAM  
1 77kb 73 0.623 reverse 5’ ATCTAAATAAATACAATCGAGGG 3’ No hits with below 10 E value including the GGG PAM No hits with below 10 E value including TGG PAM No hits with below 10 E value including AGG PAM 1 hit with 1.2 E value, 15/15 identity, includes CGG PAM  
2 45kb 44 0.667 reverse 5’ GGGTGTGTGTCTATGCATTGGGG 3’ 1 hit at 4.8 E. value, 20/22bp identity, includes GGG PAM. A few with 4.8 E value, 14/14 identity, includes CGG PAM (See image) No hits with below 10 E value including AGG PAM No hits with below 10 E value including CGG PAM  
2 45kb 54 0.662 reverse 5’ TGTGTGTGTGTGTAGTTGGGGGG 3’ 2 hits with 0.005 E value 22/23bp identity, includes GGG PAM.       very repetitive, might not be good
2 45kb 24 0.638 reverse 5’ GCGCATGTGTATATTTACCAGGG 3’ 2 hits at 4.8 E value, 14/14 identity, GGG PAM No hits with below 10 E value including TGG PAM 1 hit with 4.8 E vlaue, 14/14 identity, includes PAM No hits with below 10 E value including CGG PAM  
2 45kb 27 0.632 reverse 5’ CGCAACACACCAAAATACGATGG 3’ 1 hit with 4.8 E vlaue, 14/14 identity, includes PAM 1 hit at 1.2 E value, 15/15 identity, includes TGG PAM, 1 hit at 4.8 E value, 14/14 identity, includes TGG PAM No hits with below 10 E value including AGG PAM No hits with below 10 E value including CGG PAM  
3 75kb 32 0.784 forward 5’ GTGACCATACACACACACAGTGG 3’ None with E value below 1 (too many others to go through) 1 hit at 0.005 E value, 19/19 identity, includes TGG PAM. 1 hit at 0.02 E value, 18/18 identity, TGG PAM No hits with below 10 E value including the AGG PAM No hits with below 10 E value including the CGG PAM  
3 75kb 42 0.718 forward 5’ CAACTCGATAGAAGTCGACGGGG 3’ 1 hit at 4.8 E value, 14/14 identity, includes GGG PAM. 1 hit with 0.077 E value, 17/17 identity, includes TGG PAM 3 hits at 4.8 E value, 14/14 identity, includes AGG PAM No hits with below 10 E value including the CGG PAM very few results
3 75kb 61 0.683 reverse 5’ TGTTCGAGAGAGAGATTGAGGGG 3’ 1 hit at 0.077 E value, 17/17 identity, including GGG PAM. 2 hits at 0.3 E value, 16/16 identity, including GGG PAM 1 hit at 1.2 E value, 18/19 identity, includes TGG PAM. 5 hits at 4.8 E value, 17/18 identity, includes TGG PAM. 1 hit at 1.2 E value, 15/15 identity, includes AGG PAM. 2 hits at 4.8 E value, 17/18 identity, includes AGG PAM. 1 hit at 4.8 E value, 14/14 identity, include AGG PAM 2 hits at 4.8 E value, 17/18 identity, include CGG PAM  
3 75kb 40 0.682 forward 5’ CCCAACTCGATAGAAGTCGACGG 3’ No hits with below 10 E value including GGG PAM No hits with below 10 E value including TGG PAM 1 hit at 4.8 E value, 14/14 identity, AGG PAM 1 hit at 4.8 E value, 14/14 identity, CGG PAM Very few results
3 75kb 78 0.679 reverse 5’ ACTAGTCTAACACTATTCCGAGG 3’ No hits with below 10 E value including GGG PAM No hits with below 10 E value including TGG PAM No hits with below 10 E value including AGG PAM No hits with below 10 E value including CGG PAM No PAM hits at all!
4 130kb 40 0.713 forward 5’ CGTCGATATTGGTCACCCAGAGG 3’ No hits with below 10 E value including GGG PAM No hits with below 10 E value including TGG PAM No hits with below 10 E value including AGG PAM 1 hit at 4.8 E value, 14/14 identity, CGG PAM very few results
4 130kb 42 0.701 forward 5’ TCGATATTGGTCACCCAGAGGGG 3’ 1 hit at 4.8 E value, 14/14 identity, GGG PAM No hits with below 10 E value including TGG PAM 2 hits at 1.2 E value, 15/15 identity, includes AGG PAM No hits with below 10 E value including CGG PAM  
4 130kb 22 0.675 reverse 5’ AAAATGGCAAAAATCGAGCTCGG 3’ 1 hit at 4.8 E value, 14/14 identity, GGG PAM No hits with below 10 E value including TGG PAM No hits with below 10 E value including AGG PAM 1 hit at 4.8 E value, 14/14 identity, CGG PAM.  
4 130kb 43 0.667 forward 5’ CGATATTGGTCACCCAGAGGGGG 3’ 1 hit at 4.8 E value, 14/14 identity, GGG PAM No hits with below 10 E value including TGG PAM No hits with below 10 E value including AGG PAM No hits with below 10 E value including CGG PAM very few results
4 130kb 53 0.666 reverse 5’ ATACATATACACTTGATGGGTGG 3’ No hits with below 10 E value including GGG PAM 1 hit at 4.8 E value, 14/14 identity, TGG PAM No hits with below 10 E value including AGG PAM No hits with below 10 E value including CGG PAM  

Characteristics of sgRNA locations

77kb Region (original from grant): site set 1

  • Intergenic region: 1,727bp
  • No repeats within region
  • GC% in intergenic region: 26%
  • Flanking genes:
    • gp053 189bp
    • gp054 237bp
    • gp094-like 330bp

45kb Region: site set 2

  • Intergenic region used to find CRISPR sites: 1,198bp
  • Entire intergenic region between closest genes: 5,081bp
    • 2,018bp on left side
    • 1,904bp on the right side
  • GC% in entire intergenic region: 28%
  • 10 repeats regions within the larger region, but none within the CRISPR site region
  • Flanking genes:
    • gp30 900bp
    • gp31 378bp
    • gp32 2,940bp

75kb Region: site set 3

  • Intergenic region used to find CRISPR sites: 1,234bp
  • Entire intergeic region between closest genes: 1,948bp
    • 389bp left side
    • 424bp right side
  • GC% in entire intergenic region: 32%
  • 2 repeat regions within the larger region, but none within the CRISPR site region
  • Flanking genes:
    • gp52 1,22bp
    • gp053 189bp
    • gp054 237bp

130kb Region: site set 4

  • Intergenic region used to find CRISPR sites: 1,189bp
  • Entire intergenic region between closest genes: 2,822bp
    • 123bp left side
    • 1589bp right side
  • GC% in entire intergenic region: 30%
  • 5 repeat regions within the larger region, but none within the CRISPR site region
  • Flanking genes:
    • gp88 657bp
    • gp89 426bp
    • gp90 2748bp