Designing Primers for the 77,00-78,00bp Region of the DiNV Genome with Geneious

Using the Geneious Primer Design Tutorial as a reference, and using the guidelines for primer design from Addgene and Zymo Research

What I want out of these primers

  • Amplify a region roughly between 77,000 and 78,400bp in the DiNV genome
    • Why? Because of CRISPR sites:
    • Site 92: 77,223bp
    • Site 27: 77,384bp
    • Site 86: 77,454bp
    • Site 73: 77,892bp
  • Primer length between 18 and 24 nucleotides
  • GC content of the primers between 35-60%
  • Melting Temperature (Tm) between 50-60 degrees C
  • Melting Temperatures between the F and R primers be within ~2-3 degrees C
  • No secondary structure/hairpins

Forward Primer

  • It’s hard to design primers for this genome because it’s so AT rich!
  • Candidate 1 for forward primer: 76,921 - 76,940bp
    • Length: 20nt
    • Tm: 60.2 degrees C
    • GC content: 55%
    • No hairpin
    • Sequence: CATCGCGCACCCATCTCTAA
  • Because it’s so hard to find a Tm for the reverse that matches the one above, I looked for a second forward primer
  • Candidate 2 for forward primer: 76,760 - 76,781bp
    • Length: 22nt
    • Tm: 57.4 degrees C
    • GC content: 40.9%
    • No hairpin
    • Sequence: GTGCAAAGTCAAGTTGTCAGAT

Reverse Primer

  • Candidate 1 for reverse primer: 78,312 - 78,335bp
    • Length: 24nt
    • Tm: 58.2 degrees C
    • GC content: 37.5%
    • No hairpin
    • Sequence: TTCTTGATGTAGTTCTGCTTACGT
  • But the GC content is close to the low end in this one, so I tried finding another
  • Canidate 2 for reverse primer: 78,659 - 78,651bp
    • Length: 23nt
    • Tm: 57.5 degrees C
    • GC content: 43.5%
    • No hairpin
    • Sequence: CCTCAGTAGCCGTATCAAGTATT

Comparing the Primers

Pair #s start and stop length of PCR product Tm difference
F-1 and R-1 76,921 - 78,335bp 1,414bp 2 degrees
F-1 and R-2 76,921 - 78,651bp 1,730bp 2.7 degrees
F-2 and R-1 76,760 - 78,335bp 1,575bp 0.8 degrees
F-2 and R-2 76,760 - 78,651bp 1,891bp 0.1 degrees